Prev. |  KEGG KO K13171 > 

RIKEN DNA Bank Human Resource - SRRM1

Gene ID NCBI Gene 10250 |  KEGG hsa:10250
Gene Symbol SRRM1
Protein Name serine and arginine repetitive matrix 1
Synonyms 160-KD|POP101|SRM160
Ortholog resource in our bank

  SRRM1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095633 IRAL039B09 pOTB7 BC017315 NM_005839 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042808 ARe07A08 pKA1U5 NM_005839.3  
GACCCTGGGATAGGGAGCGATCTCCGAGCGAGGCGGCAAGATGGACGCGGGATTTTTCCG
HKR044879 ARe12D07 pKA1U5 NM_005839.3  
GGGAAAATGGCGGCGGGAATGGGCCGGGATGGTACCTCGCTGCCCGCCTGCCTGGCGGGG
HKR054427 ARe36B03 pKA1U5 NM_005839.3  
GGAGCGATCTCCGAGCGAGGCGGCAAGATGGACGCGGGATTTTTCCGCGGAACAAGTGCA
HKR243915 ARiS109N03 pGCAP10 NM_005839.3  
GGAGCGAGGCGGCAAGATGGACGCGGGATTTTTCCGCGGAACAAGTGCAGAACAGGATAA
HKR441708 RBdS104E12 pGCAP10 NM_005839.3  
GGAGCGATCTCCGAGCGAGGCGGCAAGATGGACGCGGGATTTTTCCGCGGAACAAGTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl