Prev. |  KEGG KO K21348 > 

RIKEN DNA Bank Human Resource - CALCOCO2

Gene ID NCBI Gene 10241 |  KEGG hsa:10241
Gene Symbol CALCOCO2
Protein Name calcium binding and coiled-coil domain 2
Synonyms NDP52
Featured content Influenza A relevant genes - human
Featured content Mitophagy - human
Ortholog resource in our bank

  CALCOCO2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006325 IRAK015N13 pCMV-SPORT6 BC015893 NM_005831 Full
HGY082937 IRAL007F17 pOTB7 BC004130 NM_005831 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072427 ARe81B03 pKA1U5 NM_005831.3  
GGTTGCTGTCGCGCCGCTGCTGGTTGCTGTCCCTGGACCCCTACCATGGAGGAGACCATC
HKR368950 RBd22G06 pGCAP10 NM_005831.3  
GGTCCCACTCTGCCCTGTTGCTGTCGCGCCGCTGCTGGTTGCTGTCCCTGGACCCCTACC
HKR374506 RBd36E10 pGCAP10 NM_005831.3  
GCCCACTCTGCCCTGTTGCTGTCGCGCCGCTGCTGGTTGCTGTCCCTGGACCCCTACCAT
HKR391210 RBd78A10 pGCAP10 NM_005831.3  
TGACTCTGCCCTGTTGCTGTCGCGCCGCTGCTGGTTGCTGTCCCTGGACCCCTACCATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl