Prev. |  KEGG KO K12399 > 

RIKEN DNA Bank Human Resource - AP3S2

Gene ID NCBI Gene 10239 |  KEGG hsa:10239
Gene Symbol AP3S2
Protein Name adaptor related protein complex 3 subunit sigma 2
Synonyms AP3S3|sigma3b
Featured content Lysosome (human)
Ortholog resource in our bank

  AP3S2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085017 IRAL012J01 pOTB7 BC002785 NM_005829
HGY087088 IRAL017L24 pOTB7 BC007773 NM_005829 Full/var
HGY090811 IRAL027A11 pOTB7 BC010020 NM_005829 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR124480 ARh11D08 pGCAP1 NM_005829.4  
GGGAAGTGATCGTGTTGTGGCGGAAGGAGGAGCTTTCTGGGAGTAGCCGGTGCTGAGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl