Prev. |  KEGG KO K11805 > 

RIKEN DNA Bank Human Resource - DCAF7

Gene ID NCBI Gene 10238 |  KEGG hsa:10238
Gene Symbol DCAF7
Protein Name DDB1 and CUL4 associated factor 7
Synonyms AN11|HAN11|SWAN-1|WDR68
Ortholog resource in our bank

  DCAF7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001752 IRAK004G08 pCMV-SPORT6 BC001264 NM_005828 Full/var
HGX020987 IRAK052H19 pCMV-SPORT6 BC027489 NM_005828

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276745 ARiS191O09 pGCAP10 NM_005828.3  
TGCGCCCCCTCCTCTCCTCCCTTCGGACCCATAGATCTCAGGCTCGGCTCCCCGCCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl