Prev. | 

RIKEN DNA Bank Human Resource - LRRC23

Gene ID NCBI Gene 10233 |  KEGG hsa:10233
Gene Symbol LRRC23
Protein Name leucine rich repeat containing 23
Synonyms LRPB7
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020506 IRAK051E10 pCMV-SPORT6 BC029858 NM_201650 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113229 M01C083B05 pDONR221 IMS05-C03 BC029858 NM_201650  
HGE113277 M01C083D05 pDONR221 IMS05-C03 BC029858 NM_201650  
HGE113325 M01C083F05 pDONR221 IMS05-C03 BC029858 NM_201650  
HGE113373 M01C083H05 pDONR221 IMS05-C03 BC029858 NM_201650  
HGE113421 M01C083J05 pDONR221 IMS05-C03 BC029858 NM_201650  
HGE113469 M01C083L05 pDONR221 IMS05-C03 BC029858 NM_201650  
HGE113517 M01C083N05 pDONR221 IMS05-C03 BC029858 NM_201650  
HGE113565 M01C083P05 pDONR221 IMS05-C03 BC029858 NM_201650  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR024146 ARa60G02 pKA1U5 NM_006992.3  
TTGAATCCCCTCCCCGGCTGATTTGCGCATCAGGAGGAGGACTGAGCTTATCTGACTCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl