Prev. | 

RIKEN DNA Bank Human Resource - ANGPTL7

Gene ID NCBI Gene 10218 |  KEGG hsa:10218
Gene Symbol ANGPTL7
Protein Name angiopoietin like 7
Synonyms AngX|CDT6|dJ647M16.1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083514 IRAL008N02 pOTB7 BC001881 NM_021146.4 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219812 ARiS049I20 pGCAP10 NM_021146.4 full cds  
GGCAGCCATGGTAGGGGTGGAGGTACAGGCAGCAAACAATATTTAAGATGCTGACTTGTG
HKR166129 ARi15F09 pGCAP10 NM_021146.4 full cds  
GGGGCTTGGAAGGAAAGCTATAGGCTACCCATTCAGCTCCCCTGTCAGAGACTCAAGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl