Prev. |  KEGG KO K15731 > 

RIKEN DNA Bank Human Resource - CTDSPL

Gene ID NCBI Gene 10217 |  KEGG hsa:10217
Gene Symbol CTDSPL
Protein Name CTD small phosphatase like
Synonyms C3orf8|HYA22|PSR1|RBSP3|SCP3
Ortholog resource in our bank

  CTDSPL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076946 ARe92G02 pKA1U5 NM_001008392.1  
GGCGGCTCTCCCGGGCGCGGCTCCGGGGTTCATGGTTGACNAGGCGGCGGCCGCTCGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl