Prev. |  KEGG KO K14559 > 

RIKEN DNA Bank Human Resource - MPHOSPH10

Gene ID NCBI Gene 10199 |  KEGG hsa:10199
Gene Symbol MPHOSPH10
Protein Name M-phase phosphoprotein 10
Synonyms CT90|MPP10|MPP10P|PPP1R106
Ortholog resource in our bank

  MPHOSPH10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04560 SEREX clone NGO-Br-53 (ID 1289) #1 SEREX clone NGO-Br-53 (ID 1289) #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008855 IRAK022C07 pCMV-SPORT6 BC015158 NM_005791 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR376527 RBd41F07 pGCAP10 NM_005791.1  
GGCATTGTGTCGGGAGTTGCTGACAGCCATGGCGCCGCAGGTCTGGCGTCGACGGACCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl