Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RNF41

Gene ID (NCBI) 10193
Gene Symbol RNF41
Protein Name ring finger protein 41
Synonyms FLRF|NRDP1|SBBI03
Databases KEGG hsa:10193 |  NCBI Gene 10193
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11981)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX027731 IRAK069F11 pCMV-SPORT6 BC032637 NM_194359 Full
HGY096866 IRAL042C18 pOTB7 BC024284 NM_194358 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR176004 ARi40A04 pGCAP10 NM_005785.2  
GCCCTTCCCGGGAGAGGCTGGGACCCGGCACCAGGGCAGTACTGTGGCCGCTGCGGCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl