Prev. |  KEGG KO K12881 > 

RIKEN DNA Bank Human Resource - ALYREF

Gene ID NCBI Gene 10189 |  KEGG hsa:10189
Gene Symbol ALYREF
Protein Name Aly/REF export factor
Synonyms ALY|ALY/REF|BEF|REF|THOC4
Ortholog resources KEGG ortholog (KEGG orthology K12881) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06604 pCMFlag_hsTHOC4 Expression vector of human THOC4/ALY

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY099080 IRAL047L16 pOTB7 BC052302 NM_005782 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE017913 W01A044N01 pENTR-TOPO IRAL047L16 BC052302 NM_005782  
HGE017919 W01A044N07 pENTR-TOPO IRAL047L16 BC052302 NM_005782  
HGE017921 W01A044N09 pENTR-TOPO IRAL047L16 BC052302 NM_005782  
HGE017965 W01A044P05 pENTR-TOPO IRAL047L16 BC052302 NM_005782  
HGE017971 W01A044P11 pENTR-TOPO IRAL047L16 BC052302 NM_005782  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR328545 RBb21G01 pKA1U5 NM_005782.2  
GGTGCTGACGCGCGGGCTCGAGCCGATGCCCGNCNTTTNNNCCCGCCATGGCCGACAAAA
HKR339281 RBb48D09 pGCAP1 NM_005782.2  
GATTCCGCGCCCGCCATGGCCGACAAAATGGACATGTCTCTGGACGACATCATTAAACTG
HKR341776 RBb54H08 pGCAP1 NM_005782.2  
GATTCCGCGCCCGCCATGGCCGACAAAATGGACATGTCTCTGGACGACATCATTAAACTG
HKR362148 RBd05G04 pGCAP10 NM_005782.2  
GGAGCCGATGCCCGATTCCGCGCCCGCCATGGCCGACAAAATGGACATGTCTCTGGACGA
HKR364401 RBd11A01 pGCAP10 NM_005782.2  
TCCTCGCCCGCCATGGCCGACAAAATGGACATGTCTCTGGACNACATCATTAAACTGAAC
HKR386451 RBd66C03 pGCAP10 NM_005782.2  
GGCTNNNTTNGCGGGCTCGAGCCGATGCCCGATTCCGCGCCCGCCATGGCCGACAAAATG
HKR398178 RBd95H10 pGCAP10 NM_005782.2  
GGATTCCGCGCCCGCCATGGCCGACAAAATGGACATGTCTCTGGACGACATCATTAAACT
HKR416018 RBdS040A18 pGCAP10 NM_005782.2  
TGGATTCCGCGCCCGCCATGGCCNACAAAATGGACATGTCTCTGGACGACATCATTAAAC
HKR470916 RBdS177E20 pGCAP10 NM_005782.2  
GGAGCCGATGCCCGATTCCGCGCCCGCCATGGCCGACAAAATGGACATGTCTCTGGACGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl