Prev. |  KEGG KO K20368 > 

RIKEN DNA Bank Human Resource - CNIH1

Gene ID NCBI Gene 10175 |  KEGG hsa:10175
Gene Symbol CNIH1
Protein Name cornichon family AMPA receptor auxiliary protein 1
Synonyms CNIH|CNIH-1|CNIL|TGAM77
Ortholog resources KEGG ortholog (KEGG orthology K20368) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE019308 W01A048E12 pENTR-TOPO flj0018o19 AK074781 NM_001009551  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR180173 ARi50H05 pGCAP10 NM_005776.2  
GCTCCCCCCTCCCCGGCTCTTTCACGTTCGCTTCCTTCTCCTACGTGCTGGCGCTGCTGC
HKR363748 RBd09G04 pGCAP10 NM_005776.2  
GAGAGGGCCCTGCGCCGCCTTTCTCCGCTGGCAACGGCGCCGCTCCCCGCTCCTCCTCCC
HKR382922 RBd57F02 pGCAP10 NM_005776.2  
GAGGGCTGGCGCCGCGGCGGTAGCGGTGGCGGTCGCGGCTGTGGCCGGGGGAAGTGAATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl