Prev. |  KEGG KO K19514 > 

RIKEN DNA Bank Human Resource - ATP6AP2

Gene ID NCBI Gene 10159 |  KEGG hsa:10159
Gene Symbol ATP6AP2
Protein Name ATPase H+ transporting accessory protein 2
Synonyms APT6M8-9|ATP6IP2|ATP6M8-9|ELDF10|HT028|M8-9|MRXE|MRXSH|MSTP009|PRR|RENR|XMRE|XPDS
Ortholog resource in our bank

  ATP6AP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY103927 IRAL059N15 pOTB7 BC084541 NM_005765 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006353 W01A015O17 pENTR-TOPO flj0027i08 AK075382 NM_005765  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068430 ARe71B06 pKA1U5 NM_005765.2  
TGAGCTGTCCCAGCGGAAGCGACGAAGGGACGGGACCCGGGAGCCTGGACGAGTCCGAGC
HKR260259 ARiS150K19 pGCAP10 NM_005765.2  
GGACGAAGGGACGGGACCCGGGAGCCTGGACGAGTCCGAGCGCGTCACCTCCTCACGCTG
HKR361208 RBd03A08 pGCAP10 NM_005765.2  
GAGCGGAAGCGACGAAGGGACGGGACCCGGGAGCCTGGACGAGTCCGAGCGCGTCACCTC
HKR441736 RBdS104F16 pGCAP10 NM_005765.2  
TNNGGANCCTGGACGAGTCCNANCNCGTCACCTCCTCACNCTGCGGNTGNCNCCCGTGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl