DNA Bank Top |  KEGG KO K14832 > 

RIKEN DNA Bank Human Resource - CEBPZ

Gene ID NCBI Gene 10153 |  KEGG hsa:10153
Gene Symbol CEBPZ
Protein Name CCAAT enhancer binding protein zeta
Synonyms CBF|CBF2|HSP-CBF|NOC1

Link

Ortholog resource in our bank

  CEBPZ


External database

human CEBPZ

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04940 SEREX clone NGO-Pr-10 (ID 604) #1 SEREX clone NGO-Pr-10 (ID 604) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013300 IRAK033E04 pBluescriptR BC034475 NM_005760 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018404 W01A046A04 pENTR-TOPO IRAK033E04 BC034475 NM_005760  
HGE018406 W01A046A06 pENTR-TOPO IRAK033E04 BC034475 NM_005760 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR169230 ARi23B06 pGCAP10 NM_005760.2  
GGCTTTGCCCGCCATGGCCGCAGTCAAGGAGCCTTTGGAGTTCCNTGCCAAGCGGCCTTG
HKR364969 RBd12H01 pGCAP10 NM_005760.2  
TGCTTTGCCCGCTATGGCCGCAGTCAAGGAGCCTTTGGAGTTCCATGCCAAGCGGCCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl