Prev. |  KEGG KO K07952 > 

RIKEN DNA Bank Human Resource - ARFRP1

Gene ID NCBI Gene 10139 |  KEGG hsa:10139
Gene Symbol ARFRP1
Protein Name ADP ribosylation factor related protein 1
Synonyms ARL18|ARP|Arp1
Ortholog resource in our bank

  ARFRP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB20094 pcDNA3-hARFRP1(WT)-HA Expression vector of human ARFRP1 for mammalian cells, C-teminal HA-tag.
RDB20095 pcDNA3-hARFRP1(Q79L)-HA Expression vector of human ARFRP1 mutant (Q79L) for mammalian cells, C-teminal HA-tag.
RDB20096 pcDNA3-hARFRP1(T31N)-HA Expression vector of human ARFRP1 mutant (T31N) for mammalian cells, C-teminal HA-tag.

webcatalog20220516.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR366410 RBd16A10 pGCAP10 NM_003224.3  
GGCGGTGAGGCGCGAGGCCCGAGGGGCGGCCCAGGACTCGAGGATGTACACGCTGCTGTC
HKR369225 RBd23B01 pGCAP10 NM_003224.3  
GAGCAGCGGCTCCGAGGGCGCGGCGGACGCAGGTAGGCCGCAGGCTGTGCGGTGAGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.12.05

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl