Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARFRP1

Gene ID (NCBI) 10139
Gene Symbol ARFRP1
Protein Name ADP ribosylation factor related protein 1
Synonyms ARL18|ARP|Arp1
Databases KEGG hsa:10139 |  NCBI Gene 10139
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07952)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR366410 RBd16A10 pGCAP10 NM_003224.3  
GGCGGTGAGGCGCGAGGCCCGAGGGGCGGCCCAGGACTCGAGGATGTACACGCTGCTGTC
HKR369225 RBd23B01 pGCAP10 NM_003224.3  
GAGCAGCGGCTCCGAGGGCGCGGCGGACGCAGGTAGGCCGCAGGCTGTGCGGTGAGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl