RIKEN DNA Bank Human Resource

Prev. | Human A to Z list > A >

RIKEN DNA Bank Human Resource - ARFRP1

Gene ID (NCBI)	10139
Gene Symbol	ARFRP1
Protein Name	ADP ribosylation factor related protein 1
Synonyms	ARL18\|ARP\|Arp1
Databases	KEGG hsa:10139 \| NCBI Gene 10139
Featured content	Ortholog resources in the DNA Bank (KEGG orthology K07952)

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	mRNA RefSeqs/DDBJ accession⁽¹⁾
Catalog number	5'-terminal sequence⁽²⁾
HKR366410	RBd16A10	pGCAP10	NM_003224.3
HKR366410	GGCGGTGAGGCGCGAGGCCCGAGGGGCGGCCCAGGACTCGAGGATGTACACGCTGCTGTC
HKR369225	RBd23B01	pGCAP10	NM_003224.3
HKR369225	GAGCAGCGGCTCCGAGGGCGCGGCGGACGCAGGTAGGCCGCAGGCTGTGCGGTGAGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv

2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl