Prev. |  KEGG KO K14009 > 

RIKEN DNA Bank Human Resource - BCAP31

Gene ID NCBI Gene 10134 |  KEGG hsa:10134
Gene Symbol BCAP31
Protein Name B-cell receptor associated protein 31
Synonyms 6C6-AG|BAP31|CDM|DDCH|DXS1357E
Ortholog resources KEGG ortholog (KEGG orthology K14009) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056138 IRAK140F18 pCMV-SPORT6 BC065292 NM_005745 Full
HGY092513 IRAL031E17 pDNR-LIB BC014323 NM_005745 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE027038 W01A067J22 pENTR-TOPO flj0004g16 AK057613 NM_005745  
HGE033866 W01A084L02 pENTR-TOPO flj0004g16 AK057613 NM_005745  
HGE033868 W01A084L04 pENTR-TOPO flj0004g16 AK057613 NM_005745  
HGE033870 W01A084L06 pENTR-TOPO flj0004g16 AK057613 NM_005745  
HGE033874 W01A084L10 pENTR-TOPO flj0004g16 AK057613 NM_005745  
HGE033880 W01A084L16 pENTR-TOPO flj0004g16 AK057613 NM_005745  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076835 ARe92B11 pKA1U5 NM_005745.6  
GGGGAGAGTTCGGTTTGCTGCGGCGGGGCCTGCACGTTGACTGTGGGAAACTCGGAAACA
HKR172851 ARi32C03 pGCAP10 NM_005745.6  
TGGCGGTATGAGGGGCGGGGCCGGGGCTGCTGTGGGAGAGTTCGGTTGCTGCGGCGGGGC
HKR174099 ARi35E03 pGCAP10 NM_005745.6  
GGGGGCTGCTGTGGGAGAGTTCGGTTGCTGCGGCGGGGCCTGCACGTTGACTGTGGGAAA
HKR235180 ARiS087P20 pGCAP10 NM_005745.6  
GCTCCNNGACGGTGTGCCAGGCCGGGGCCAAGTCGGAGGCCCCTCGCTCTGGGTGGGCGC
HKR247306 ARiS118E10 pGCAP10 NM_005745.6  
GGGTTGCTGCGGCGGGGCCTGCACGTTGACTGTGGGAAACTCGGAAACAAGCTCACATCT
HKR347606 RBb69A06 pGCAP1 NM_005745.6  
GGGGGCTGCTGTGGGAGAGTTCGGTTGCTGCGGCGGGGCCTGCACGTTGACTGTGGGAAA
HKR376004 RBd40A04 pGCAP10 NM_005745.6  
GGGGGCTGCTGTGGGAGAGTTCGGTTGCTGCGGCGGGGCCTGCACGTTGACTGTGGGAAA
HKR390084 RBd75D12 pGCAP10 NM_005745.6  
GGGGGCTGCTGTGGGAGAGTTCGGTTGCTGCGGCGGGGCCTGCACGTTGACTGTGGGAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl