DNA Bank Top |  KEGG KO K19946 > 

RIKEN DNA Bank Human Resource - OPTN

Gene ID NCBI Gene 10133 |  KEGG hsa:10133
Gene Symbol OPTN
Protein Name optineurin
Synonyms ALS12|FIP2|GLC1E|HIP7|HYPL|NRP|TFIIIA-INTP
Featured content Mitophagy - human

Link

Ortholog resource in our bank

  OPTN

External database

human OPTN

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB16709 GFP-OPTN-E478G Expression vector of human optineurin (OPTN), amyotrophic lateral sclerosis (ALS)-associated E478G mutant.    
RDB16708 GFP-OPTN-E50K Expression vector of human optineurin (OPTN), amyotrophic lateral sclerosis (ALS)-associated E50K mutant.    
RDB16707 GFP-OPTN-WT Expression vector of human optineurin (OPTN).    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027213 IRAK068A13 pCMV-SPORT6 BC032762 NM_021980 Full/var
HGY085727 IRAL014F07 pOTB7 BC013876 NM_021980 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022524 W01A056F04 pENTR-TOPO flj0013h05 AK055403 NM_021980  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044858 ARe12C10 pKA1U5 NM_021980.4  
GGCCCCCTCCGCCACCGCCGCCGCCCGCCGGCAGGTTCCCTGGTCAGCGTCCCATCCCGG
HKR057772 ARe44H04 pKA1U5 NM_021980.4  
ATCCTGGGCCCCCTCCGCCACCGCCGCCGCCCGCCGGTNAGGATTCCCTGGTCAGCGTCC
HKR168550 ARi21G06 pGCAP10 NM_021980.4  
NNCTGAGCCGCGCTGGGCGGGGTCGCCAGGCCGCGCATCGCCCCCAGGCACCCCAGTCCC
HKR339773 RBb49H05 pGCAP1 NM_021980.4  
GCCCCTCCGCCACCNCCGCCGCCCGCCGGNAGGNTTCCCTGCCCCCNTNAAANNCCATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl