Prev. |  KEGG KO K09488 > 

RIKEN DNA Bank Human Resource - TRAP1

Gene ID NCBI Gene 10131 |  KEGG hsa:10131
Gene Symbol TRAP1
Protein Name TNF receptor associated protein 1
Synonyms HSP 75|HSP75|HSP90L|TRAP-1
Ortholog resource in our bank

  TRAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081773 IRAL004H05 pOTB7 BC001455 NM_016292 Partial/var
HGY090657 IRAL026K17 pOTB7 BC018950 NM_016292 Full/var
HGY093350 IRAL033G06 pOTB7 BC023585 NM_016292 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038007 W01A095A07 pENTR-TOPO IRAL026K17 BC018950 NM_016292  
HGE038009 W01A095A09 pENTR-TOPO IRAL026K17 BC018950 NM_016292  
HGE038013 W01A095A13 pENTR-TOPO IRAL026K17 BC018950 NM_016292  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234328 ARiS085N16 pGCAP10 NM_016292.2  
GCTTCCCATCGTGTACGGTCCCGCGTGGCTGCGCGCGGCGCTCTGGGAGTACGACATGGC
HKR330153 RBb25G09 pGCAP1 NM_016292.2  
GGCTCTGGGAGTACGACATGGCGCGCGAGCTGCGGGCGCTGCTGCTGTGGGGCCGCCGCC
HKR347628 RBb69B04 pGCAP1 NM_016292.2  
GGAGTACGACATGGCGCGCGAGCTGCGGGCGCTGCTGCTGTGGGGCCGCCGCCTGCGGCC
HKR347680 RBb69D08 pGCAP1 NM_016292.2  
GCCCGCGTGGCTGCGCGCGGCGCTCTGGGAGTACGACATGGCGCGCGAGCTGCGGGCGCT
HKR376929 RBd42F09 pGCAP10 NM_016292.2  
TCGCTTCCCATCGTGTACGGTCCCGCGTGGCTGCGCGCGGCGCTCTGGGAGTACGACATG
HKR406377 RBdS015P17 pGCAP10 NM_016292.2  
GGCGAGCTGCGGGCGCTGCTGCTGTGGGGCCGCCGCCTGCGGCCTTTGCTGCGGGCGCCG
HKR432706 RBdS081M18 pGCAP10 NM_016292.2  
HKR441719 RBdS104E23 pGCAP10 NM_016292.2  
GGAGTACGACATGGCGCGCGAGCTGCGGGCGCTGCTGCTGTGGGGCCGCCGCCTGCGGCC
HKR444133 RBdS110F13 pGCAP10 NM_016292.2  
GGCTGCGCGCGGCGCTCTGGGAGTACGACATGGCGCGCGAGCTGCGGGCGCTGCTGCTGT
HKR462571 RBdS156H03 pGCAP10 NM_016292.2  
GCCCGCGTGGCTGCGCGCGGCGCTCTGGGAGTACGACATGGCGCGCGAGCTGCGGGCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl