Prev. |  KEGG KO K17964 > 

RIKEN DNA Bank Human Resource - LRPPRC

Gene ID NCBI Gene 10128 |  KEGG hsa:10128
Gene Symbol LRPPRC
Protein Name leucine rich pentatricopeptide repeat containing
Synonyms CLONE-23970|GP130|LRP130|LSFC
Ortholog resource in our bank

  LRPPRC

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036193 IRAK090I01 pBluescript BC050311 NM_133259 Full
HGX001435 IRAK003J19 pCMV-SPORT6 BC010282 NM_133259 Partial
HGY028033 IRAK070B09 pBluescriptR BC038181 NM_133259 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE016882 W01A042D10 pENTR-TOPO flj0068h11 AK125781 NM_133259  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045330 ARe13F10 pKA1U5 NM_133259.3  
GCTTCTGGCGGAGCGTGCTTCCCGCTGCGGGGACGTTCGAGCAATGGCAGCCCTGCTGAG
HKR330878 RBb27D06 pGCAP1 NM_133259.3  
GCTTCTGGCGGAGCGTGCTTCCCGCTGCGGGGACGTTCGAGCAATGGCAGCCCTGCTGAG
HKR420488 RBdS051D16 pGCAP10 NM_133259.3  
GGCTTCCCNCTGCGGGGACNTNCGAGCAATGGCAGCCCTGCTGAGATCCGCGCGTTGGTT
HKR432620 RBdS081J04 pGCAP10 NM_133259.3  
GGNGCGTNCCGCTGCNGGNACGTTCNAGCAATGGNANNCNNGCTGAGATCCNCGCGTTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl