Prev. |  KEGG KO K07945 > 

RIKEN DNA Bank Human Resource - ARL4C

Gene ID NCBI Gene 10123 |  KEGG hsa:10123
Gene Symbol ARL4C
Protein Name ADP ribosylation factor like GTPase 4C
Synonyms ARL7|LAK
Ortholog resources KEGG ortholog (KEGG orthology K07945) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056474 ARe41D02 pKA1U5 NM_005737.3  
GGTGAGGCTGCCGAGCGGACAGCGACTCCCGGGGAATCCCGCGCTCCGGGAGCGGGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl