Prev. |  KEGG KO K07945 > 

RIKEN DNA Bank Human Resource - ARL4C

Gene ID NCBI Gene 10123 |  KEGG hsa:10123
Gene Symbol ARL4C
Protein Name ADP ribosylation factor like GTPase 4C
Synonyms ARL7|LAK
Ortholog resource in our bank

  ARL4C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056474 ARe41D02 pKA1U5 NM_005737.3 Full done
GGTGAGGCTGCCGAGCGGACAGCGACTCCCGGGGAATCCCGCGCTCCGGGAGCGGGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl