Prev. |  KEGG KO K16575 > 

RIKEN DNA Bank Human Resource - ACTR1B

Gene ID NCBI Gene 10120 |  KEGG hsa:10120
Gene Symbol ACTR1B
Protein Name actin related protein 1B
Synonyms ARP1B|CTRN2|PC3
Ortholog resource in our bank

  ACTR1B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085472 IRAL013L08 pOTB7 BC004374 NM_005735 Full
HGY087056 IRAL017K16 pOTB7 BC006372 NM_005735 Full/var
HGY090820 IRAL027A20 pOTB7 BC010090 NM_005735 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006282 W01A015L18 pENTR-TOPO IRAL013L08 BC004374 NM_005735  
HGE006284 W01A015L20 pENTR-TOPO IRAL013L08 BC004374 NM_005735  
HGE006288 W01A015L24 pENTR-TOPO IRAL013L08 BC004374 NM_005735  
HGE046670 W01A116L06 pENTR-TOPO IRAL017K16 BC006372 NM_005735  
HGE046674 W01A116L10 pENTR-TOPO IRAL017K16 BC006372 NM_005735  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR071283 ARe78D11 pKA1U5 NM_005735.3  
GAGGCTGCAGGCTCGGGGAGGGAGGGCAGCGGCGCCGCGTCGGGAGCCGCCGCCGTCCCG
HKR247249 ARiS118C01 pGCAP10 NM_005735.3  
TAGGGCAGCGGCGCCGCGTCGGGAGCCGCCGCCGTCCCGGTCCTCCNGCCNGCCCGCCCA
HKR386430 RBd66B06 pGCAP10 NM_005735.3  
GGCCCGCCCGCCCATCCGGTGCCTCCTGCAGCCCGCCTGCTGGGCAGGGCCGGCGCGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl