Prev. |  KEGG KO K08826 > 

RIKEN DNA Bank Human Resource - HIPK3

Gene ID NCBI Gene 10114 |  KEGG hsa:10114
Gene Symbol HIPK3
Protein Name homeodomain interacting protein kinase 3
Synonyms DYRK6|FIST3|PKY|YAK1
Ortholog resource in our bank

  HIPK3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061653 ARe54C05 pKA1U5 NM_005734.3 done
GGCCCGGGCTGGGCGCGCAGCGCTGCCGGGCGGGCGGTGGCGCTGCGGAGGCGGTGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl