Prev. |  KEGG KO K09565 > 

RIKEN DNA Bank Human Resource - PPIF

Gene ID NCBI Gene 10105 |  KEGG hsa:10105
Gene Symbol PPIF
Protein Name peptidylprolyl isomerase F
Synonyms CYP3|CyP-M|Cyp-D|CypD
Featured content Parkinson disease - human
Featured content Huntington disease - human
Ortholog resource in our bank

  PPIF

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085296 IRAL013D24 pOTB7 BC005020 NM_005729 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR372809 RBd32A09 pGCAP10 NM_005729.3  
GGCCCGTGTCCCGCCCGACCCGCGCCCGCGATGCTGGCGCTGCGCTGCGGCTCCCGCTGG
HKR376970 RBd42H02 pGCAP10 NM_005729.3  
GACTCGGCCTTCTGGGCGCGCGCGACGTCAGTTTGAGTTCTGTGTTCTCCCCGCCCGTGT
HKR442188 RBdS105H20 pGCAP10 NM_005729.3  
GACTCGGCCTTCTGGGCGCGCGCGACGTCAGTTTGAGTTCTGTGTTCTCCCCGCCCGTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl