Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUBP2

Gene ID (NCBI) 10101
Gene Symbol NUBP2
Protein Name nucleotide binding protein 2
Synonyms CFD1|NBP 2|NUBP1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085160 IRAL012O24 pOTB7 BC002768 NM_012225 Full
HGY089312 IRAL023E16 pOTB7 BC008005 NM_012225 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR079777 ARe99H09 pKA1U5 NM_012225.2
GACTGCAGCCGCGAGCTCCTGGAGGCGGCGGGATGGAGGCGGCGGCCGAGCCTGGAAACC
HKR264778 ARiS161P18 pGCAP10 NM_012225.2
GGGACTGCAGCCGCGAGCTCCTGGAGGCGGCGGGATGGAGGCGGCGGCCGAGCCTGGAAA
HKR366170 RBd15H02 pGCAP10 NM_012225.2
GCTGCAGCCGCGAGCTCCTGGAGGCGGCGGGATGGAGGCGGCGGCCGTAGAGACGGGGTT
HKR374404 RBd36A04 pGCAP10 NM_012225.2
GAGCGGACTGCAGCCGCGAGCTCCTGGAGGCGGCGGGATGGAGGCGGCGGCCGAGCCTGG
HKR398898 RBd97E02 pGCAP10 NM_012225.2
GGCGAGCTCCTGGAGGCGGCGGGATGGAGGCGGCGGCCGAGCCTGGAAACCTGGCCGGCG
HKR452913 RBdS132E17 pGCAP10 NM_012225.2
GGGGCGTAAGCGGACTGCAGCCGCGAGCTCCTGGAGGCGGCGGGATGGAGGCGGCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl