Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACTR3

Gene ID (NCBI) 10096
Gene Symbol ACTR3
Protein Name ARP3 actin-related protein 3 homolog (yeast)
Synonyms ARP3
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K18584)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY042578 IRAK106H10 pBluescript BC044590 NM_005721 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE086017 M01C015A17 pDONR221 FLJ05-A09 BC044590 NM_005721  
HGE086065 M01C015C17 pDONR221 FLJ05-A09 BC044590 NM_005721  
HGE086113 M01C015E17 pDONR221 FLJ05-A09 BC044590 NM_005721  
HGE086161 M01C015G17 pDONR221 FLJ05-A09 BC044590 NM_005721  
HGE086209 M01C015I17 pDONR221 FLJ05-A09 BC044590 NM_005721  
HGE086257 M01C015K17 pDONR221 FLJ05-A09 BC044590 NM_005721  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045355 ARe13G11 pKA1U5 NM_005721.3  
GCTTGCTACTGCTTCGGCTTCCCGGCTACCCCCCGGACGGTGAAGGCGGCCCAGCTGTGG
HKR166501 ARi16E05 pGCAP10 NM_005721.3  
GGAGGGGGAGGAGGCCGCGGCGGGGCAGGGCGGGGACTGCCTGCCTGCCTGGGTTGCGGA
HKR175704 ARi39E08 pGCAP10 NM_005721.3  
GCCCCCGGACGGTGAAGGCGGCCCAGCTGTGGATGGTCAGATAGCCCTTGTCTCCCGCCG
HKR070525 ARe76F05 pKA1U5 NM_005721.3  
GGCGGCGGGGCAGGGCGGGGACTGCCTGCCTGCCTTGGTTGCGGAAGTGATAGCCGCCGA
HKR234978 ARiS087H10 pGCAP10 NM_005721.3  
CGGCCGGCCGATGGCCTGCCTGCCTGGGTTGCGGAAGTGATAGCCGCCGACCGAGCCTGC
HKR322907 RBb07E11 pKA1U5 NM_005721.3  
GGGCGGCCATCTTGGCTTCCCGGGGAAAGGCGNCGTTGAGGGGAAGAAGTTGTAGGGTGG
HKR430233 RBdS075J17 pGCAP10 NM_005721.3  
GAGCGGCGCTGCGGCGGCTCGCGGGAGACGCTGCGCGCGGGGCTAGCGGGCGGCGGAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl