Prev. |  KEGG KO K05757 > 

RIKEN DNA Bank Human Resource - ARPC1B

Gene ID NCBI Gene 10095 |  KEGG hsa:10095
Gene Symbol ARPC1B
Protein Name actin related protein 2/3 complex subunit 1B
Synonyms ARC41|p40-ARC|p41-ARC
Ortholog resources KEGG ortholog (KEGG orthology K05757) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081917 IRAL004N05 pOTB7 BC002562 NM_005720 Full
HGY083631 IRAL009B07 pOTB7 BC002988 NM_005720 Full
HGY088888 IRAL022D16 pOTB7 BC007555 NM_005720 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162580 ARi06H12 pGCAP10 NM_005720.2  
GAGAGCCGGTTCGGCGCGTCGACTGCCCAGAGTCCGCGGCCGGGGCGCGGGAGGAGCCAA
HKR165207 ARi13A07 pGCAP10 NM_005720.2  
GAGAGCCGGTTCGGCGCGTCGACTGCCCAGAGTCCGCGGCCGGGGCGCGGGAGGAGCCAA
HKR165349 ARi13G05 pGCAP10 NM_005720.2  
GGAAGTGGCTGCTGCTCCGGCGCGGAGCCCAGAGCCGGTTCGGCGCGTCGACTGCCCAGA
HKR175774 ARi39H06 pGCAP10 NM_005720.2  
ACGAGGAAGTGGCTGCTGCTCCGGCGCGGAGCCCAGAGCCGGTTCGGCGCGTCGACTGCC
HKR179772 ARi49H04 pGCAP10 NM_005720.2  
GAGAGCCGGTTCGGCGCGTCGACTGCCCAGAGTCCGCGGCCGGGGCGCGGGAGGAGCCAA
HKR185775 ARi64H07 pGCAP10 NM_005720.2  
HKR264587 ARiS161H19 pGCAP10 NM_005720.2  
GCCAGAGCCGGTTCGGCGCGTCGACTGCCCAGAGTCCGCGGCCGGGGCGCGGGAGGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl