Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARPC3

Gene ID (NCBI) 10094
Gene Symbol ARPC3
Protein Name actin related protein 2/3 complex, subunit 3, 21kDa
Synonyms ARC21|p21-Arc
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY067356 IRAK168G12 pBluescriptR BC067747 NM_005719 Full
HGX069833 IRAK174J17 pCMV-SPORT6 BC078162 NM_005719 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163370 ARi08H02 pGCAP10 NM_005719.2  
TGGTACCTGGATCCTGCTCCTCTGGGTTGAAACCCGGGCGCCGCCAAGATGCCGGCTTAC
HKR046079 ARe15D07 pKA1U5 NM_005719.2  
GGCCTACCTCGCCCAGGCTGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTGCTCCT
HKR166077 ARi15D05 pGCAP10 NM_005719.2  
GTTTCGCTTCCGCCTACCTCGCCCAGGCTGCCAGACCGGAAGCGCTCCGCTGTACCTGGA
HKR054499 ARe36E03 pKA1U5 NM_005719.2  
GGTACCTGGATCCTGCTCCTCTGGGTTGAAACCCGGGCGCCGCCAAGATGCCGGCTTACC
HKR066479 ARe66D07 pKA1U5 NM_005719.2  
ATCCTGGCCTACCTCGCCCAGGCTGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTG
HKR075210 ARe88A10 pKA1U5 NM_005719.2  
GACCTGGATCCTGCTCCTCTGGGTTGAAACCCGGGCGCCGCCAAGATGCCGGCTTACCAC
HKR218015 ARiS045A15 pGCAP10 NM_005719.2  
GAGACCGGANGCGCTCCGCTGTACCTGGATCCTGCTCCTCTGGGTTGAAACCCGGGCGCC
HKR235004 ARiS087I12 pGCAP10 NM_005719.2  
GTCCGCCTACCTCGCCCAGGCTGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTGCT
HKR247366 ARiS118G22 pGCAP10 NM_005719.2  
GGGGTTGAAACCCGGGCGCCGCCAAGATGCCGGCTTACCACTCTTCTCTCATGGATCCTG
HKR347232 RBb68B08 pGCAP1 NM_005719.2  
TTTTTTTTTTTTTTTGCAGGCTGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTGCT
HKR405891 RBdS014M03 pGCAP10 NM_005719.2  
CGGCCGGCCGATGCCTCCTCTGGGTTGAAACCCGGGCGCCGCCAAGATGCCGGCTTACCA
HKR416039 RBdS040B15 pGCAP10 NM_005719.2  
GGCCCAGGCTGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTGCTCCTCTGGGTTGA
HKR428001 RBdS070A01 pGCAP10 NM_005719.2  
GGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTGCTCCTCTGGGTTGAAACCCGGGC
HKR428252 RBdS070K12 pGCAP10 NM_005719.2  
GGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTGCTCCTCTGGGTTGAAACCCGGGC
HKR442061 RBdS105C13 pGCAP10 NM_005719.2  
GATCCTGCTCCTCTGGGTTGAAACCCGGGCGCCGCCAAGATGCCGGCTTACCACTCTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl