Prev. |  KEGG KO K05756 > 

RIKEN DNA Bank Human Resource - ARPC3

Gene ID NCBI Gene 10094 |  KEGG hsa:10094
Gene Symbol ARPC3
Protein Name actin related protein 2/3 complex subunit 3
Synonyms ARC21|p21-Arc
Featured content Endocytosis (human)
Ortholog resource in our bank

  ARPC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067356 IRAK168G12 pBluescriptR BC067747 NM_005719 Full
HGX069833 IRAK174J17 pCMV-SPORT6 BC078162 NM_005719 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046079 ARe15D07 pKA1U5 NM_005719.2  
GGCCTACCTCGCCCAGGCTGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTGCTCCT
HKR054499 ARe36E03 pKA1U5 NM_005719.2  
GGTACCTGGATCCTGCTCCTCTGGGTTGAAACCCGGGCGCCGCCAAGATGCCGGCTTACC
HKR066479 ARe66D07 pKA1U5 NM_005719.2  
ATCCTGGCCTACCTCGCCCAGGCTGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTG
HKR075210 ARe88A10 pKA1U5 NM_005719.2  
GACCTGGATCCTGCTCCTCTGGGTTGAAACCCGGGCGCCGCCAAGATGCCGGCTTACCAC
HKR163370 ARi08H02 pGCAP10 NM_005719.2  
TGGTACCTGGATCCTGCTCCTCTGGGTTGAAACCCGGGCGCCGCCAAGATGCCGGCTTAC
HKR166077 ARi15D05 pGCAP10 NM_005719.2  
GTTTCGCTTCCGCCTACCTCGCCCAGGCTGCCAGACCGGAAGCGCTCCGCTGTACCTGGA
HKR218015 ARiS045A15 pGCAP10 NM_005719.2  
GAGACCGGANGCGCTCCGCTGTACCTGGATCCTGCTCCTCTGGGTTGAAACCCGGGCGCC
HKR235004 ARiS087I12 pGCAP10 NM_005719.2  
GTCCGCCTACCTCGCCCAGGCTGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTGCT
HKR247366 ARiS118G22 pGCAP10 NM_005719.2  
GGGGTTGAAACCCGGGCGCCGCCAAGATGCCGGCTTACCACTCTTCTCTCATGGATCCTG
HKR347232 RBb68B08 pGCAP1 NM_005719.2  
TTTTTTTTTTTTTTTGCAGGCTGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTGCT
HKR405891 RBdS014M03 pGCAP10 NM_005719.2  
CGGCCGGCCGATGCCTCCTCTGGGTTGAAACCCGGGCGCCGCCAAGATGCCGGCTTACCA
HKR416039 RBdS040B15 pGCAP10 NM_005719.2  
GGCCCAGGCTGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTGCTCCTCTGGGTTGA
HKR428001 RBdS070A01 pGCAP10 NM_005719.2  
GGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTGCTCCTCTGGGTTGAAACCCGGGC
HKR428252 RBdS070K12 pGCAP10 NM_005719.2  
GGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTGCTCCTCTGGGTTGAAACCCGGGC
HKR442061 RBdS105C13 pGCAP10 NM_005719.2  
GATCCTGCTCCTCTGGGTTGAAACCCGGGCGCCGCCAAGATGCCGGCTTACCACTCTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl