Prev. |  KEGG KO K05755 > 

RIKEN DNA Bank Human Resource - ARPC4

Gene ID NCBI Gene 10093 |  KEGG hsa:10093
Gene Symbol ARPC4
Protein Name actin related protein 2/3 complex subunit 4
Synonyms ARC20|P20-ARC
Featured content Endocytosis (human)
Ortholog resource in our bank

  ARPC4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056683 IRAK141L19 pCMV-SPORT6 BC065423 NM_005718 Full
HGY087960 IRAL019O24 pDNR-LIB BC012596 NM_005718 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164569 ARi11H01 pGCAP10 NM_005718.3  
GGCTTTCCGGCCCAGCCAGCGCCCGCGATGACTGCCACTCTCCGCCCCTACCTGAGTGCC
HKR219769 ARiS049H01 pGCAP10 NM_005718.3  
GACTTCCGTACTTCCGCTTTCCGGCCCAGCCAGCGCCCGCGATGACTGCCACTCTCCGCC
HKR324153 RBb10G09 pKA1U5 NM_005718.3  
GAGCCAGCGCCCGCGATGACTGCCACTCTCCGCCCCTACCTGAGTGCCGTGCGGGCCACA
HKR366174 RBd15H06 pGCAP10 NM_005718.3  
GGAGCTGCGGGTAGGAGGGGCGAGAGAAAGGATGGGGGTACAGAACCGGAAGAAACGAAG
HKR384099 RBd60E03 pGCAP10 NM_005718.3  
GGCTGGCCACTTCCGTACTTCCGCTTTCCGGCCCAGCCAGCGCCCGCGATGACTGCCACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl