Prev. |  KEGG KO K01277 > 

RIKEN DNA Bank Human Resource - DPP3

Gene ID NCBI Gene 10072 |  KEGG hsa:10072
Gene Symbol DPP3
Protein Name dipeptidyl peptidase 3
Synonyms DPPIII
Ortholog resource in our bank

  DPP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081723 IRAL004F03 pOTB7 BC001446 NM_130443 Full/var
HGY089099 IRAL022M11 pOTB7 BC007221 NM_130443 Full
HGY091571 IRAL028P11 pOTB7 BC014038 NM_130443 Full
HGY096898 IRAL042E02 pOTB7 BC024271 NM_130443 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234898 ARiS087E02 pGCAP10 NM_130443.2  
GGTGAGTTTGCGAACGGAGCAGCTGCTGCAGCAGGGCCCATGGCGGACACCCAGTACATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl