Prev. |  KEGG KO K19995 > 

RIKEN DNA Bank Human Resource - SCAMP3

Gene ID NCBI Gene 10067 |  KEGG hsa:10067
Gene Symbol SCAMP3
Protein Name secretory carrier membrane protein 3
Synonyms C1orf3
Ortholog resource in our bank

  SCAMP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001319 IRAK003E23 pCMV-SPORT6 BC000161 NM_005698 Full
HGX007955 IRAK019O19 pCMV-SPORT6 BC010505 NM_052837 Full
HGY082990 IRAL007H22 pOTB7 BC005135 NM_005698 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR442384 RBdS105P24 pGCAP10 NM_005698.2  
TTGCCCTTCCGGTCGATGGAACCAATCCGTGCACAGAGAAGCGGGGCGAACTGAGGCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl