Prev. |  KEGG KO K01890 > 

RIKEN DNA Bank Human Resource - FARSB

Gene ID NCBI Gene 10056 |  KEGG hsa:10056
Gene Symbol FARSB
Protein Name phenylalanyl-tRNA synthetase subunit beta
Synonyms FARSLB|FRSB|HSPC173|NEDBLLA|PheHB|PheRS|RILDBC
Ortholog resource in our bank

  FARSB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13278 pUC-T7-EMCV-His-PheRSbeta EMCV IRES-dependent expression vector of human phenylalanyl-tRNA synthetase beta subunit

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY094639 IRAL036J23 pDNR-LIB BC017783 NM_005687 Full/var
HGY081051 IRAL002K11 pOTB7 BC006502 NM_005687 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096814 M01C042A14 pDONR221 MGC10-F07 BC017783 ENST00000281828  
HGE096862 M01C042C14 pDONR221 MGC10-F07 BC017783 ENST00000281828  
HGE096910 M01C042E14 pDONR221 MGC10-F07 BC017783 ENST00000281828  
HGE096958 M01C042G14 pDONR221 MGC10-F07 BC017783 ENST00000281828  
HGE097006 M01C042I14 pDONR221 MGC10-F07 BC017783 ENST00000281828  
HGE097054 M01C042K14 pDONR221 MGC10-F07 BC017783 ENST00000281828  
HGE097102 M01C042M14 pDONR221 MGC10-F07 BC017783 ENST00000281828  
HGE097150 M01C042O14 pDONR221 MGC10-F07 BC017783 ENST00000281828  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR169283 ARi23D11 pGCAP10 NM_005687.3  
GGCAGTGAGTTCGACACACCATGCCGACTGTCAGCGTGAAGCGTGATCTGCTCTTCCAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl