Prev. |  KEGG KO K12393 > 

RIKEN DNA Bank Human Resource - AP1M2

Gene ID NCBI Gene 10053 |  KEGG hsa:10053
Gene Symbol AP1M2
Protein Name adaptor related protein complex 1 mu 2 subunit
Synonyms AP1-mu2|HSMU1B|MU-1B|MU1B|mu2
Ortholog resources KEGG ortholog (KEGG orthology K12393) in the DNA Bank
Featured content Lysosome (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001352 IRAK003G08 pCMV-SPORT6 BC003387 NM_005498 Full
HGY081333 IRAL003F13 pOTB7 BC003612 NM_005498 Full
HGY087251 IRAL018C03 pOTB7 BC005021 NM_005498 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR277762 ARiS194G18 pGCAP10 NM_005498.3  
GAGCGATGCCGACTCCCCCAGATTCAAGACCAGTGTGGGCAGCGCCAAGTATGTGCCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl