Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GJC1

Gene ID (NCBI) 10052
Gene Symbol GJC1
Protein Name gap junction protein gamma 1
Synonyms CX45|GJA7
Databases KEGG hsa:10052 |  NCBI Gene 10052
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07616)


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE010320 W01A025N08 pENTR-TOPO flj0041a17 AK124339 NM_005497  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR333746 RBb34G02 pGCAP1 NM_005497.3  
GGGCGGCGGCGGCGGCAGCGGCGGGAGCGGCTTCTGCCTCGGCTGGAGACTGAGGCGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl