Prev. |  KEGG KO K11298 > 

RIKEN DNA Bank Human Resource - HMGXB4

Gene ID NCBI Gene 10042 |  KEGG hsa:10042
Gene Symbol HMGXB4
Protein Name HMG-box containing 4
Synonyms HMG2L1|HMGBCG|THC211630
Ortholog resource in our bank

  HMGXB4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027339 IRAK068F19 pCMV-SPORT6 BC033783 NM_014250 Partial/var
HGX056565 IRAK141G21 pCMV-SPORT6 BC062413 NM_014250 Partial/var
HGY084505 IRAL011E09 pOTB7 BC004194 NM_014250 Partial/var
HGY091115 IRAL027N03 pOTB7 BC011723 NM_014250 Partial
HGY095691 IRAL039D19 pOTB7 BC017326 NM_014250 Partial/var
HGY096826 IRAL042B02 pOTB7 BC025303 NM_014250 Partial/var
HGY099132 IRAL047N20 pOTB7 BC052624 NM_014250 Partial
HGY103760 IRAL059G16 pOTB7 BC080611 NM_014250 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053604 ARe34A04 pKA1U5 NM_001003681.2  
GCTTCTCCAGATGGCGGCGATCGGCGGCGTTGAGGCGGGATCCGGGCGAGCCGAGTGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl