Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PARP2

Gene ID (NCBI) 10038
Gene Symbol PARP2
Protein Name poly(ADP-ribose) polymerase 2
Synonyms ADPRT2|ADPRTL2|ADPRTL3|ARTD2|PARP-2|pADPRT-2
Databases KEGG hsa:10038 |  NCBI Gene 10038
Featured content DNA repair (human)
Featured content Apoptosis - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10798)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR394580 RBd86H12 pGCAP10 NM_001042618.1  
GGATGACGTCAGCGTTCGAATTCCATGGCGGCGCGGCGGCGACGGAGCACCGGCGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl