Prev. |  KEGG KO K10750 > 

RIKEN DNA Bank Human Resource - CHAF1A

Gene ID NCBI Gene 10036 |  KEGG hsa:10036
Gene Symbol CHAF1A
Protein Name chromatin assembly factor 1 subunit A
Synonyms CAF-1|CAF1|CAF1B|CAF1P150|P150
Ortholog resources KEGG ortholog (KEGG orthology K10750) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY097894 IRAL044M06 pOTB7 BC041606 NM_005483 Partial/var
HGY085950 IRAL014O14 pOTB7 BC005813 NM_005483
HGY099118 IRAL047N06 pOTB7 BC052620 NM_005483 Partial/var
HGY100301 IRAL050M13 pOTB7 BC067093 NM_005483 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR067634 ARe69B10 pKA1U5 NM_005483.2  
GGCGGTTCCCGCCAAATACGAGCGCGGCGGCCGCTTTCGGCAGCAGCGGCGCGGGCGGNA
HKR324850 RBb12C02 pKA1U5 NM_005483.2  
GGCGCGGCGGCCGCGGCGGCAGCAGCGGCAGCNCCNTNCGCGGGCGGGAGGGCGAACAGC
HKR462632 RBdS156J16 pGCAP10 NM_005483.2  
GGCCAAATACGAGCGCGGCGGCCGCGGCGGCAGCAGCGGCAGCAGCGGCGCGGGCGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl