Prev. |  KEGG KO K15159 > 

RIKEN DNA Bank Human Resource - MED16

Gene ID NCBI Gene 10025 |  KEGG hsa:10025
Gene Symbol MED16
Protein Name mediator complex subunit 16
Synonyms DRIP92|THRAP5|TRAP95
Ortholog resource in our bank

  MED16

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086334 IRAL015N22 pOTB7 BC004554 NM_005481 Full/var
HGY088244 IRAL020K04 pOTB7 BC007853 NM_005481 Partial/var
HGY091395 IRAL028I03 pOTB7 BC011841 NM_005481 Full/var
HGY095802 IRAL039I10 pOTB7 BC017282 NM_005481 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050801 ARe27A01 pKA1U5 NM_005481.2  
TGGGGAGGCGGCCCCACGCCCTCAGGCGACTGGTTGTTACCGAGGAAGATGGCGGCGCCA
HKR430203 RBdS075I11 pGCAP10 NM_005481.2  
GAGGCNACTGGTTGTTACCGAGGAANATGGNNGCNCCNNACCCNANGNGCTAGGGAANAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl