Prev. |  KEGG KO K11407 > 

RIKEN DNA Bank Human Resource - HDAC6

Gene ID NCBI Gene 10013 |  KEGG hsa:10013
Gene Symbol HDAC6
Protein Name histone deacetylase 6
Synonyms CPBHM|HD6|JM21|PPP1R90
Ortholog resources KEGG ortholog (KEGG orthology K11407) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06377 pCMFlag_hsHDAC6 Expression vector of human HDAC6

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001563 IRAK003P03 pCMV-SPORT6 BC013737 NM_006044 Partial
HGY101982 IRAL054P22 pOTB7 BC069243 NM_006044 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR346580 RBb66H12 pGCAP1 NM_006044.2  
GCCCCTGAGGAGCGGGGCTGGTTGAAACGCTAGGGGCGGGATCTGGCGGAGTGGAAGAAC
HKR363371 RBd08H03 pGCAP10 NM_006044.2  
GGGGGCAGTCCCCTGAGGAGCGGGGCTGGTTGAAACGCTAGGGGCGGGATCTGGCGGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl