RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - HDAC6

Gene ID	NCBI Gene 10013 \| KEGG hsa:10013
Gene Symbol	HDAC6
Protein Name	histone deacetylase 6
Synonyms	CPBHM\|HD6\|JM21\|PPP1R90

Ortholog resource in our bank

  HDAC6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB06377	pCMFlag_hsHDAC6	Expression vector of human HDAC6.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGX001563	IRAK003P03	pCMV-SPORT6	BC013737	NM_006044	Partial
HGY101982	IRAL054P22	pOTB7	BC069243	NM_006044	Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR346580	RBb66H12	pGCAP1	NM_006044.2
HKR346580	GCCCCTGAGGAGCGGGGCTGGTTGAAACGCTAGGGGCGGGATCTGGCGGAGTGGAAGAAC
HKR363371	RBd08H03	pGCAP10	NM_006044.2
HKR363371	GGGGGCAGTCCCCTGAGGAGCGGGGCTGGTTGAAACGCTAGGGGCGGGATCTGGCGGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl