Prev. | 

RIKEN DNA Bank Human Resource - SRA1

Gene ID NCBI Gene 10011 |  KEGG hsa:10011
Gene Symbol SRA1
Protein Name steroid receptor RNA activator 1
Synonyms SRA|SRAP|STRAA1|pp7684
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035678 IRAK089D06 pCMV-SPORT6 BC040043 NM_001035235 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074482 ARe86D10 pKA1U5 NM_001035235.2  
GGGAAGTGGAGATGGCGGAGCTGTACGTGAAGCCGGGCAACAAGGAACGCGGCTGGAACG
HKR077306 ARe93E10 pKA1U5 NM_001035235.2  
GGGAGATGGCGGAGCTGTACGTGAAGCCGGGCAACAAGGAACGCGGCTGGAACGACCCGC
HKR379273 RBd48D01 pGCAP10 NM_001035235.2  
GGAAGTGGAGATGGCGGAGCTGTACGTGAAGCCGGGCAACAAGGAACGCGGCTGGAACGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl