DNA Bank Top |  KEGG KO K12650 > 

RIKEN DNA Bank Human Resource - TANK

Gene ID NCBI Gene 10010 |  KEGG hsa:10010
Gene Symbol TANK
Protein Name TRAF family member associated NFKB activator
Synonyms I-TRAF|ITRAF|TRAF2

Link

Ortholog resource in our bank

  TANK

External database

human TANK

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB05932 pAxCALNLhTANK (forward) Shuttle vector to generate rAd harboring human TANK (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067278 IRAK168D06 pBluescriptR BC067779 NM_004180 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168460 ARi21C12 pGCAP10 NM_004180.2  
GGGTTGGAGTCACTCGGCCAGGCGCCGGCGACCTGAGGGGAGAGGGAACGCAGCTGAAAG
HKR276648 ARiS191K08 pGCAP10 NM_004180.2  
GACTCGGCCAGGCGCCGGCGACCTGAGGGGAGAGGGAACGCAGCTGAAAGCGTGAACTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl