Prev. |  KEGG KO K02564 > 

RIKEN DNA Bank Human Resource - GNPDA1

Gene ID NCBI Gene 10007 |  KEGG hsa:10007
Gene Symbol GNPDA1
Protein Name glucosamine-6-phosphate deaminase 1
Synonyms GNP1|GNPDA|GNPI|GPI|HLN
Ortholog resources KEGG ortholog (KEGG orthology K02564) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008616 IRAK021I24 pCMV-SPORT6 BC012853 NM_005471 Full
HGY094014 IRAL035A14 pDNR-LIB BC020769 NM_005471 Full
HGY094045 IRAL035B21 pDNR-LIB BC022322 NM_005471

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR218331 ARiS045N19 pGCAP10 NM_005471.4  
GCAGTCgCTGCAgCCGCCGCGGGAGGCGTCCGTGACAAGATGAAGCTCATCATCCTGGAG
HKR277799 ARiS194I07 pGCAP10 NM_005471.4  
GGACCCNCGCGGGGCCGGGCCGCCGGCGCAGTCGCTGCAGCCGCCGCGGGAGGCGTCCG
HKR416304 RBdS040M16 pGCAP10 NM_005471.4  
GGCAGTCGCTGCAGCCGCCGCGGGAGGCGTCCGTGACAAGATGAAGCTCATCATCCTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl