Prev. | 

RIKEN DNA Bank Human Resource - ABI1

Gene ID NCBI Gene 10006 |  KEGG hsa:10006
Gene Symbol ABI1
Protein Name abl interactor 1
Synonyms ABI-1|ABLBP4|E3B1|NAP1BP|SSH3BP|SSH3BP1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084669 IRAL011L05 pOTB7 BC024254 NM_001012752 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR203403 ARiS008I11 pGCAP10 NM_001012750.1  
CGGCCGGCCGATGCNCTTTAACGCGAGAGGAAGCGATGCAGAGGGGTGGAAAATGGCAGA
HKR372130 RBd30F10 pGCAP10 NM_001012750.1  
GGTATCCGGGCTGTGAGGTGCTCGGAGCCTCGGCGGACCTTGCTGCCTCTGTCTCTTTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl