Prev. |  KEGG KO K07152 > 

RIKEN DNA Bank Human Resource - SCO2

Gene ID NCBI Gene 9997 |  KEGG hsa:9997
Gene Symbol SCO2
Protein Name synthesis of cytochrome C oxidase 2
Synonyms CEMCOX1|ECGF1|Gliostatin|MC4DN2|MYP6|PD-ECGF|SCO1L|TP|TYMP|TdRPase
Ortholog resource in our bank

  SCO2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07415 pGL4-phSCO2 Promoter collection, Human SCO2 promoter

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050457 ARe26C09 pKA1U5 NM_005138.2  
GGCTCTGCATGGACGGCGCAGGCCCGCCAGACTTAAGGGACCTGGTCACCACGCTCGGTG
HKR177651 ARi44C03 pGCAP10 NM_005138.2  
TGAGGCCCAGGGCGCTGCCCGGGTGGCCGCGGCGCTGGACGACGGCTCGGCCCTTGGCCG
HKR330524 RBb26F04 pGCAP1 NM_005138.2  
GGCCGGCGGGGCAGAGCGCAGGGAGCTGGAGGTCGGCGCTTCCTCTCGTGCTTGGTCCAC
HKR433246 RBdS083B22 pGCAP10 NM_005138.2  
GGAGCGTGTGGCGCCCGCTTTCCCTGAGCCGGCGGGGCAGAGCGCAGGGAGCTGGAGGTC
HKR442071 RBdS105C23 pGCAP10 NM_005138.2  
GGAGTGGTCCTGGAACCTTTCTGGCCACGAGGGCGCTGGCCTTGCTGGGGAGGGCACAAA
HKR462733 RBdS156N21 pGCAP10 NM_005138.2  
GACTCAGGCTCAGGGCGCTGCCCGGGTGGCCGCGGCGCTGGACGACGGCTCGGCCCTTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl