Prev. |  KEGG KO K13044 > 

RIKEN DNA Bank Human Resource - HNRNPDL

Gene ID NCBI Gene 9987 |  KEGG hsa:9987
Gene Symbol HNRNPDL
Protein Name heterogeneous nuclear ribonucleoprotein D like
Synonyms HNRNP|HNRPDL|JKTBP|JKTBP2|LGMD1G|laAUF1
Ortholog resources KEGG ortholog (KEGG orthology K13044) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY089776 IRAL024H08 pOTB7 BC007392 NM_031372 Partial
HGY091035 IRAL027J19 pOTB7 BC011714 NM_031372 Full
HGY103344 IRAL058F24 pOTB7 BC071944 NM_031372 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE032207 W01A080I15 pENTR-TOPO IRAL027J19 BC011714 NM_031372  
HGE032211 W01A080I19 pENTR-TOPO IRAL027J19 BC011714 NM_031372  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041723 ARe04F03 pKA1U5 NM_031372.2  
GCTCTTCCGCCGCCATTTTAAATCCAGCTCCATACAACGCTCCGCCGCCGCTGCTGCCGC
HKR075375 ARe88H07 pKA1U5 NM_031372.2  
GCTCTTCCGCCGCCATTTTAAATCCAGCTCCATACAACGCTCCGCCGCCGCTGCTGCCGC
HKR171204 ARi28A04 pGCAP10 NM_031372.2  
GCTCTTCCGCCGCCATTTTAAATCCAGCTCCATACAACGCTCCGCCGCCGCTGCTGCCGC
HKR175282 ARi38D10 pGCAP10 NM_031372.2  
GCTCTTCCGCCGCCATTTTAAATCCAGCTCCATACAACGCTCCGCCGCCGCTGCTGCCGC
HKR264698 ARiS161M10 pGCAP10 NM_031372.2  
GGCGCTCNNCGCCTCAGTCGCCAGCGCCGGGCGCAGTCCGCCTTTTTCCGGAGCAGACTG
HKR325256 RBb13C08 pKA1U5 NM_031372.2  
GGAAGCGAACGCGGGAGCAGGGCTGCGCGAGAGCGCGCCCTCCGCAGACAGGTTGAGCGA
HKR364131 RBd10F11 pGCAP10 NM_031372.2  
GGCTGCTGCCGCGACCCGGACTGCGCGCCAGCACCCCCCTGCCGACAGCTCCGTCACTAT
HKR370407 RBd26A07 pGCAP10 NM_031372.2  
GCTCTTCCGCCGCCATTTTAAATCCAGCTCCATACAACGCTCCGCCGCCGCTGCTGCCGC
HKR408973 RBdS022H05 pGCAP10 NM_031372.2  
GATCTCTTCCGCCGCCATTTTAAATCCAGCTCCATACAACGCTCCGCCGCCGCTGCTGCC
HKR461874 RBdS154L10 pGCAP10 NM_031372.2  
GGATCTCTTCCGCCGCCATTTTAAATCCAGCTCCATACAACGCTCCGCCGCCGCTGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl