Prev. |  KEGG KO K08531 > 

RIKEN DNA Bank Human Resource - NR1D2

Gene ID NCBI Gene 9975 |  KEGG hsa:9975
Gene Symbol NR1D2
Protein Name nuclear receptor subfamily 1 group D member 2
Synonyms BD73|EAR-1R|REVERBB|REVERBbeta|RVR
Ortholog resource in our bank

  NR1D2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06269 pCMFlag_hsNR1D2 Expression vector of human NR1D2.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006221 IRAK015J05 pCMV-SPORT6 BC015929 NM_005126 Partial/var
HGY019330 IRAK048F10 pBluescriptR BC045613 NM_005126 Full
HGY066804 IRAK167A04 pBluescriptR BC070035 NM_005126 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002725 W01A006N13 pENTR-TOPO IRAK048F10 BC045613 NM_005126  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055629 ARe39B05 pKA1U5 NM_005126.3  
GGGCTGCAGGAAGCCGCCGCGCCGCCGCTTTTGTTGTCAGGGACCCAGCGAGGAGCGCCG
HKR248847 ARiS122B23 pGCAP10 NM_005126.3  
GGTCANCCGCCCTCNCCNCCNCGGTGCNCTGGCTGCNNGAANCCGCCGCGCCGCCGCTTT
HKR335371 RBb38H03 pGCAP1 NM_005126.3  
GAGCCGCCCTCGCCGCCGCGGTTGCGCTGGCTGCAGGAAGCCGCCGCGCCGCCGCTTTTG
HKR461742 RBdS154F22 pGCAP10 NM_005126.3  
GACGGGTCACATGGTCGCGGCTGCCCTCCCCGTCAGCCGCCCTCGCCGCCGCGGTGCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl