Prev. |  KEGG KO K21343 > 

RIKEN DNA Bank Human Resource - USP15

Gene ID NCBI Gene 9958 |  KEGG hsa:9958
Gene Symbol USP15
Protein Name ubiquitin specific peptidase 15
Synonyms UNPH-2|UNPH4
Ortholog resources KEGG ortholog (KEGG orthology K21343) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX054044 IRAK135B20 pCMV-SPORT6 BC063454 NM_006313

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078497 ARe96E01 pKA1U5 NM_006313.1  
GGGAAGAAGATGGCGGAAGGCGGAGCGGCGGATCTGGACACCCAGCGGTCTGACATCGCG
HKR174907 ARi37E11 pGCAP10 NM_006313.1  
TGGGAAGAAGATGGCGGAAGGCGGAGCGGCGGATCTGGACACCCAGCGGTCTGACATCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl