Prev. |  KEGG KO K10476 > 

RIKEN DNA Bank Human Resource - KBTBD11

Gene ID NCBI Gene 9920 |  KEGG hsa:9920
Gene Symbol KBTBD11
Protein Name kelch repeat and BTB domain containing 11
Synonyms KLHDC7C
Ortholog resource in our bank

  KBTBD11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR402953 RBdS007G09 pGCAP10 NM_014867.2 No cds done
GGGCTGAAGAGGAGCCGCGGCGAGGAAAAGAAAAGGAACAAATCAGTGCAGCGAGCTTTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl