Prev. |  KEGG KO K20353 > 

RIKEN DNA Bank Human Resource - SEC16A

Gene ID NCBI Gene 9919 |  KEGG hsa:9919
Gene Symbol SEC16A
Protein Name SEC16 homolog A, endoplasmic reticulum export factor
Synonyms KIAA0310|SEC16L|p250
Ortholog resource in our bank

  SEC16A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX024828 IRAK062B04 pCMV-SPORT6 BC028183 XM_946054 Full/var
HGX035879 IRAK089L15 pCMV-SPORT6 BC040710 XM_946041 Partial
HGX069757 IRAK174G13 pCMV-SPORT6 BC070488 XM_946041 Partial
HGY081704 IRAL004E08 pOTB7 BC001404 XM_946050 Full/var
HGY089292 IRAL023D20 pOTB7 BC008332 XM_946046 Full/var
HGY098808 IRAL047A08 pOTB7 BC051290 XM_946043 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE082004 M01C005A04 pDONR221 04-134-2_3-B02 AK094756 XM_931432  
HGE082052 M01C005C04 pDONR221 04-134-2_3-B02 AK094756 XM_931432  
HGE082100 M01C005E04 pDONR221 04-134-2_3-B02 AK094756 XM_931432  
HGE082148 M01C005G04 pDONR221 04-134-2_3-B02 AK094756 XM_931432  
HGE082196 M01C005I04 pDONR221 04-134-2_3-B02 AK094756 XM_931432  
HGE082244 M01C005K04 pDONR221 04-134-2_3-B02 AK094756 XM_931432  
HGE082292 M01C005M04 pDONR221 04-134-2_3-B02 AK094756 XM_931432  
HGE082340 M01C005O04 pDONR221 04-134-2_3-B02 AK094756 XM_931432  
HGE110837 M01C077B13 pDONR221 06-2_02-C07 AK094756 XM_931432  
HGE110885 M01C077D13 pDONR221 06-2_02-C07 AK094756 XM_931432  
HGE110933 M01C077F13 pDONR221 06-2_02-C07 AK094756 XM_931432  
HGE110981 M01C077H13 pDONR221 06-2_02-C07 AK094756 XM_931432  
HGE111029 M01C077J13 pDONR221 06-2_02-C07 AK094756 XM_931432  
HGE111077 M01C077L13 pDONR221 06-2_02-C07 AK094756 XM_931432  
HGE111125 M01C077N13 pDONR221 06-2_02-C07 AK094756 XM_931432  
HGE111173 M01C077P13 pDONR221 06-2_02-C07 AK094756 XM_931432  
HGE085619 M01C014A19 pDONR221 FLJ04-E10 AK094756 XM_931432  
HGE085667 M01C014C19 pDONR221 FLJ04-E10 AK094756 XM_931432  
HGE085715 M01C014E19 pDONR221 FLJ04-E10 AK094756 XM_931432  
HGE085763 M01C014G19 pDONR221 FLJ04-E10 AK094756 XM_931432  
HGE085811 M01C014I19 pDONR221 FLJ04-E10 AK094756 XM_931432  
HGE085859 M01C014K19 pDONR221 FLJ04-E10 AK094756 XM_931432  
HGE085907 M01C014M19 pDONR221 FLJ04-E10 AK094756 XM_931432  
HGE085955 M01C014O19 pDONR221 FLJ04-E10 AK094756 XM_931432  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR367351 RBd18G07 pGCAP10 NM_001276418.2 full cds  
GGCGAGGAGCGCGCCCGCGTCAGGGCCCCGCGCTTCTCAGCTGGGCGGAGTAGCCGTTCT
HKR397256 RBd93C08 pGCAP10 NM_014866.1  
GATGTGCCAAGATGGCTGCGGCGGCTGAGGTGTCTGTGCTCGTCGCCAGCGTCGGGTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl