Prev. |  KEGG KO K11316 > 

RIKEN DNA Bank Human Resource - SUPT7L

Gene ID NCBI Gene 9913 |  KEGG hsa:9913
Gene Symbol SUPT7L
Protein Name SPT7 like, STAGA complex subunit gamma
Synonyms SPT7L|STAF65|STAF65(gamma)|STAF65G|SUPT7H
Ortholog resource in our bank

  SUPT7L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069982 IRAK174P22 pCMV-SPORT6 BC074000 NM_014860 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022254 W01A055K14 pENTR-TOPO flj0064f13 AK000616 NM_014860  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR388973 RBd72H05 pGCAP10 NM_014860.1  
GGAGAAGAAGCGCTTCCGGCGGTCTTAGATCACTAATCAACAAACCAGCTTTCGGGGTCT
HKR405858 RBdS014K18 pGCAP10 NM_014860.1  
ACTAATCAACAAACCAGCTTTCGGGGTCTGACGCGATCCTTGCCTCAGGCCTCTCGAGGT
HKR420456 RBdS051C08 pGCAP10 NM_014860.1  
GGGAAACCCCTGGAGGGACTTGGGCATTCCTTGGGCTCCGTGCCTGTTCTTCGTGCTCCT
HKR432626 RBdS081J10 pGCAP10 NM_014860.1  
GGAAGCGCTTCCGGCGGTCTTAGATCACTAATCAACAAACCAGCTTTCGGGGTCTGACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl