Prev. | 

RIKEN DNA Bank Human Resource - TMCC2

Gene ID NCBI Gene 9911 |  KEGG hsa:9911
Gene Symbol TMCC2
Protein Name transmembrane and coiled-coil domain family 2
Synonyms HUCEP11
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046142 IRAK115F22 pCMV-SPORT6 BC053876 NM_014858 Partial/var
HGY097615 IRAL044A15 pOTB7 BC041019 NM_014858

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE020751 W01A051O15 pENTR-TOPO flj0073o22 AK131419 NM_014858  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR361777 RBd04H09 pGCAP10 NM_014858.2  
GAGTCTGGAGATGGCGGCTGCAGAGTCTGGGAACTCAGGCACACCTGCTCGCAGCCCAGT
HKR382480 RBd56D08 pGCAP10 NM_014858.2  
GGGGGAAATCTCCTAGAGCAATCCGCCCCTAATCCCCAGGCTGNGCNTCAGTCTGGAGAT
HKR383250 RBd58C02 pGCAP10 NM_014858.2  
GAGTCTGGAGATGGCGGCTGCAGAGTCTGGGAACTCAGGCACACCTGCTCGCAGCCCAGT
HKR416036 RBdS040B12 pGCAP10 NM_014858.2  
GAGGCTGTGCCTCAGTCTGGAGATGGCGGCTGCAGAGTCTGGGAACTCAGGCACACCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl