Prev. |  KEGG KO K06258 > 

RIKEN DNA Bank Human Resource - SV2B

Gene ID NCBI Gene 9899 |  KEGG hsa:9899
Gene Symbol SV2B
Protein Name synaptic vesicle glycoprotein 2B
Synonyms HsT19680
Ortholog resource in our bank

  SV2B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013534 IRAK033N22 pBluescriptR BC030011 NM_014848 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR372408 RBd31A08 pGCAP10 NM_014848.4  
GGTGGGCGCGGTGATGCAGGTGTGACACCCGCCGGCGCCTGCCTCCGCCCGGATCGCCCA
HKR409014 RBdS022I22 pGCAP10 NM_014848.4  
GGGAGCTGCACGCGGGGCTGCCGGGGCGGACGCTGCTCTGCCTGCATCCGGAGGCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl